Detail of EST/Unigene AW695848 |
Acc. | AW695848 |
Internal Acc. | NF099D01ST1F1012 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Tryptophan synthase beta chain 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-31; Tryptophan synthase beta chain 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-30; Tryptophan synthase beta chain 2, chloroplastic OS=Camptotheca acuminata E-value=4e-28; Tryptophan synthase beta chain 2, chloroplastic (Fragment) OS=Zea mays E-value=1e-27; Tryptophan synthase beta chain 1 (Fragment) OS=Zea mays E-value=1e-21; |
Length | 457 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CAACACACAAAAAAACACAAACAAATCTAACATGGCGTTCATCAATCACAAACCTTAACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828815 |
Trichome-related Gene from Literature | N/A |