| Detail of EST/Unigene AW695848 |
| Acc. | AW695848 |
| Internal Acc. | NF099D01ST1F1012 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Tryptophan synthase beta chain 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-31; Tryptophan synthase beta chain 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-30; Tryptophan synthase beta chain 2, chloroplastic OS=Camptotheca acuminata E-value=4e-28; Tryptophan synthase beta chain 2, chloroplastic (Fragment) OS=Zea mays E-value=1e-27; Tryptophan synthase beta chain 1 (Fragment) OS=Zea mays E-value=1e-21; |
| Length | 457 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CAACACACAAAAAAACACAAACAAATCTAACATGGCGTTCATCAATCACAAACCTTAACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828815 |
| Trichome-related Gene from Literature | N/A |