Detail of EST/Unigene AW695904 |
Acc. | AW695904 |
Internal Acc. | NF099H04ST1F1043 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase CVP2 OS=Arabidopsis thaliana E-value=3e-14; Type I inositol 1,4,5-trisphosphate 5-phosphatase 2 OS=Arabidopsis thaliana E-value=2e-10; Type I inositol 1,4,5-trisphosphate 5-phosphatase 1 OS=Arabidopsis thaliana E-value=2e-09; |
Length | 591 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | AACGCTCAAAGAACCAACTCCATCTTAAGATATTGGTCTTAGTGTGTTTGTGGCTTGCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.1.3.36 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837048 |
Trichome-related Gene from Literature | N/A |