Detail of EST/Unigene AW695953 |
Acc. | AW695953 |
Internal Acc. | NF101A05ST1F1036 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase large chain OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=8e-46; Carbamoyl-phosphate synthase large chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=6e-42; Carbamoyl-phosphate synthase large chain OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=2e-37; Carbamoyl-phosphate synthase large chain OS=Gemmatimonas aurantiaca (strain T-27 / DSM 14586 / JCM 11422 / NBRC 100505) E-value=2e-36; Carbamoyl-phosphate synthase large chain OS=Brucella melitensis biotype 1 (strain 16M / ATCC 23456 / NCTC 10094) E-value=3e-34; |
Length | 471 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CTTCTGCTCTTGCTAGTAAGGCTACTGGGTTTCCAATAGCAGAAGATGGCGTGCAAAGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01948 carbamoyl-phosphate synthase (ammonia) |
EC | 6.3.4.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839868 |
Trichome-related Gene from Literature | N/A |