Detail of EST/Unigene AW696127 |
Acc. | AW696127 |
Internal Acc. | NF102F09ST1F1078 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=5e-76; Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=3e-72; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=4e-71; Aldo-keto reductase family 4 member C8 OS=Arabidopsis thaliana E-value=1e-62; Alcohol dehydrogenase [NADP(+)] OS=Gallus gallus E-value=1e-43; |
Length | 664 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CAGCAATCAAATTCTTTCAGTTGAACACTGGTGCTAAAATCCCTTCTGTTGGTTTAGGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+) |
EC | 1.1.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818354 |
Trichome-related Gene from Literature | N/A |