| Detail of EST/Unigene AW696474 |
| Acc. | AW696474 |
| Internal Acc. | NF104D12ST1F1101 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 4, mitochondrial OS=Arabidopsis thaliana E-value=5e-90; NifU-like protein 5, mitochondrial OS=Arabidopsis thaliana E-value=3e-89; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Drosophila melanogaster E-value=2e-60; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Drosophila sechellia E-value=5e-60; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Drosophila yakuba E-value=9e-60; |
| Length | 580 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | AGGAGGAGTATGTTTATCCAAACACAGTCCACTCCTAATCCAGAGTCTCTTATGTTTCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821647 |
| Trichome-related Gene from Literature | N/A |