Detail of EST/Unigene AW696903 |
Acc. | AW696903 |
Internal Acc. | NF110C03ST1F1020 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase, glyoxysomal OS=Cucurbita maxima E-value=4e-23; Citrate synthase 3, peroxisomal OS=Arabidopsis thaliana E-value=2e-22; Citrate synthase 2, peroxisomal OS=Arabidopsis thaliana E-value=2e-21; Citrate synthase 1, peroxisomal OS=Arabidopsis thaliana E-value=2e-18; Citrate synthase OS=Dictyostelium discoideum E-value=1e-12; |
Length | 634 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | GTACGTAACACCAATCTACGTACATGGAAGACGTGAATCTCAGTTTTGACTCCAATTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818879 |
Trichome-related Gene from Literature | N/A |