Detail of EST/Unigene AW696919 |
Acc. | AW696919 |
Internal Acc. | NF112B08ST1F1064 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable inactive heme oxygenase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-40; Probable inactive heme oxygenase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-33; Heme oxygenase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-29; Heme oxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-29; Heme oxygenase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-26; |
Length | 655 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | AGAATCTGCAAACAAGCAATCGAAATAGCATTGCAATGTTGTTAACAGCGAAACCCACTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817196 |
Trichome-related Gene from Literature | N/A |