Detail of EST/Unigene AW697071 |
Acc. | AW697071 |
Internal Acc. | NF112A07ST1F1052 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=2e-46; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=7e-44; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=7e-44; Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=6e-37; |
Length | 657 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CGATCTTCATTATCTAATGGATCCATTTCACCAAAACGACGCTTCTTCATCTTTTCCACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837069 |
Trichome-related Gene from Literature | N/A |