| Detail of EST/Unigene AW697172 |
| Acc. | AW697172 |
| Internal Acc. | NF115H11ST1F1095 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | GMP synthase [glutamine-hydrolyzing] OS=Thermus thermophilus (strain HB8 / ATCC 27634 / DSM 579) E-value=4e-18; GMP synthase [glutamine-hydrolyzing] OS=Thermus thermophilus (strain HB27 / ATCC BAA-163 / DSM 7039) E-value=4e-18; GMP synthase [glutamine-hydrolyzing] OS=Prochlorococcus marinus (strain MIT 9312) E-value=9e-18; GMP synthase [glutamine-hydrolyzing] OS=Prochlorococcus marinus (strain MIT 9215) E-value=2e-17; GMP synthase [glutamine-hydrolyzing] OS=Prochlorococcus marinus (strain MIT 9301) E-value=2e-17; |
| Length | 379 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTGAGTGGAGTTGGTTCTACTAGCAAGAGAGTACAGCAGCCAACAACATAAACCCTAGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01951 GMP synthase (glutamine-hydrolysing) |
| EC | 6.3.5.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842670 |
| Trichome-related Gene from Literature | N/A |