Detail of EST/Unigene AW736050 |
Acc. | AW736050 |
Internal Acc. | EST332036 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Leucine aminopeptidase 2, chloroplastic OS=Solanum lycopersicum E-value=9e-18; Leucine aminopeptidase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-17; Leucine aminopeptidase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-17; Leucine aminopeptidase 1 OS=Arabidopsis thaliana E-value=7e-17; Leucine aminopeptidase, chloroplastic OS=Solanum tuberosum E-value=1e-15; |
Length | 179 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | CTGCTACGGATGTTGATGTGACTGAATGGAAAGGAGATATACTAGCAGTGGGTGTTACTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829215 |
Trichome-related Gene from Literature | N/A |