Detail of EST/Unigene AW736326 |
Acc. | AW736326 |
Internal Acc. | EST332245 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=1e-61; Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=3e-52; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=1e-39; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=4e-36; Sulfite reductase [ferredoxin] OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=1e-29; |
Length | 369 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | GATAACTGGCTGCCCTAATGGTTGTGCTAGACCTTATATGGCAGAACTAGGACTGGTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830336 |
Trichome-related Gene from Literature | 830336 |