Detail of EST/Unigene AW736536 |
Acc. | AW736536 |
Internal Acc. | EST332550 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastidial pyruvate kinase 2 OS=Arabidopsis thaliana E-value=2e-46; Pyruvate kinase isozyme G, chloroplastic OS=Nicotiana tabacum E-value=3e-40; Plastidial pyruvate kinase 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-38; Pyruvate kinase isozyme G, chloroplastic (Fragment) OS=Ricinus communis E-value=2e-26; Pyruvate kinase OS=Bacillus psychrophilus E-value=4e-16; |
Length | 303 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | ATGTCGCTCGTATGAATATGTCTCATGGTGATCATGCTTCTCATAAGAAAGTTATTGATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
EC | 2.7.1.40 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835369 |
Trichome-related Gene from Literature | N/A |