| Detail of EST/Unigene AW773880 |
| Acc. | AW773880 |
| Internal Acc. | EST332866 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Peroxinectin A OS=Dictyostelium discoideum E-value=3e-09; |
| Length | 627 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | GAAATACAAAACATGATTTTATTCTTGAACGGACAGATGATTATTTTGAAAGATACAAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00430 peroxidase; Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00430 peroxidase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00430 peroxidase |
| EC | 1.11.1.7 1.14.99.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821135 |
| Trichome-related Gene from Literature | N/A |