Detail of EST/Unigene AW773958 |
Acc. | AW773958 |
Internal Acc. | EST332944 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=6e-67; Fructan 6-exohydrolase OS=Beta vulgaris E-value=4e-56; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=9e-52; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=3e-50; Beta-fructofuranosidase, insoluble isoenzyme 7 OS=Oryza sativa subsp. japonica E-value=7e-43; |
Length | 634 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | CTTACAATTCTTATCAAATCAAATGTTGTAAATAAAATGAAACTTTGTATACTTCAATGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |