| Detail of EST/Unigene AW774540 |
| Acc. | AW774540 |
| Internal Acc. | EST333691 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Copper methylamine oxidase OS=Arthrobacter sp. (strain P1) E-value=5e-50; Primary amine oxidase OS=Arthrobacter sp. (strain P1) E-value=5e-50; Histamine oxidase OS=Arthrobacter globiformis E-value=6e-43; Copper amine oxidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-42; Copper amine oxidase 1 OS=Aspergillus niger E-value=2e-41; |
| Length | 642 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | TTTATTATATATTCTGTTGCATATGTTGATGGTAGTCGAGGGAGAAGGCCTGTGGCTCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00960 Alkaloid biosynthesis II > K00276 primary-amine oxidase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00276 primary-amine oxidase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00276 primary-amine oxidase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00276 primary-amine oxidase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00276 primary-amine oxidase |
| EC | 1.4.3.21 1.4.3.22 1.4.3.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818849 |
| Trichome-related Gene from Literature | N/A |