Detail of EST/Unigene AW774694 |
Acc. | AW774694 |
Internal Acc. | EST333845 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=1e-52; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=3e-50; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=3e-50; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-49; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=5e-49; |
Length | 720 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | TCGGAATTAACTATGGTAGAACAGCTGATAACCTACCAACACCATCAAAGGTAGTAGAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835611 |
Trichome-related Gene from Literature | N/A |