| Detail of EST/Unigene AW774742 |
| Acc. | AW774742 |
| Internal Acc. | EST333893 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-carotene hydroxylase 2, chloroplastic (Fragment) OS=Capsicum annuum E-value=2e-73; Beta-carotene 3-hydroxylase, chloroplastic OS=Gentiana lutea E-value=2e-72; Beta-carotene 3-hydroxylase 1, chloroplastic OS=Arabidopsis thaliana 1 E-value=3e-72; Beta-carotene 3-hydroxylase 2, chloroplastic OS=Arabidopsis thaliana 2 E-value=2e-71; Beta-carotene hydroxylase 1, chloroplastic OS=Capsicum annuum E-value=2e-70; |
| Length | 632 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | AATAAAAAGAACATCCTGCTGTATCTTATTACTAAAAGTCTAAATCTGTACAAACACATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |