Detail of EST/Unigene AW774813 |
Acc. | AW774813 |
Internal Acc. | EST333964 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=2e-61; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=4e-55; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=2e-51; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Daucus carota E-value=5e-50; Beta-fructofuranosidase, insoluble isoenzyme 2 OS=Daucus carota E-value=5e-48; |
Length | 401 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | TTATGTCAATGGTATTCTTCCTATTGAAGCTACTCACCATGTTTATAGAAACCTTCAGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |