| Detail of EST/Unigene AW775101 |
| Acc. | AW775101 |
| Internal Acc. | EST334252 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 5 OS=Homo sapiens E-value=1e-39; Replication factor C subunit 5 OS=Mus musculus E-value=3e-39; Probable replication factor C subunit 5 OS=Dictyostelium discoideum E-value=2e-31; Replication factor C subunit 3 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-24; Probable replication factor C subunit 5 OS=Caenorhabditis elegans E-value=2e-20; |
| Length | 686 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | GATTTTATAAAATCTAATTTGATCTCCAAAAGTTAACAAACGAAACATGCTCCATCAGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10756 replication factor C subunit 3/5 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844083 |
| Trichome-related Gene from Literature | N/A |