Detail of EST/Unigene AW929293 |
Acc. | AW929293 |
Internal Acc. | EST338081 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-81; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=4e-79; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-77; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=1e-77; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=4e-77; |
Length | 470 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_FLOWERBUDS3; |
Sequence | GTTCAAGAGTTTCTCATTCTACTTCTATAAGGGCTACTGGTACCATGGCTCTTTCTTCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |