Detail of EST/Unigene AW944992 |
Acc. | AW944992 |
Internal Acc. | EST337042 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=5e-27; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=4e-23; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=4e-21; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=6e-21; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=8e-21; |
Length | 185 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_flower_buds8; |
Sequence | CTCCTTCTTTTGCCGGACAGGCAGAGAAACTCTCACCCTCTGCCTCACAAATCTCTGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |