Detail of EST/Unigene AY389346 |
Acc. | AY389346 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Malus domestica E-value=0; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Pyrus communis E-value=0; Dihydroflavonol-4-reductase OS=Vitis vinifera E-value=0; Dihydroflavonol-4-reductase OS=Dianthus caryophyllus E-value=0; Dihydroflavonol-4-reductase OS=Arabidopsis thaliana E-value=0; |
Length | 1331 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GCCAACCAAAATCACTAGAGAAAAAAAAATCAGGGAAAAAACAGAGAAAATAAAATATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
EC | 1.1.1.- 1.1.1.145 1.1.1.170 5.3.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834291 |
Trichome-related Gene from Literature | 834291 |