| Detail of EST/Unigene AY804253 |
| Acc. | AY804253 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=0; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=0; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=0; Lichenase OS=Nicotiana plumbaginifolia E-value=0; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=0; |
| Length | 1113 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_CDS; |
| Sequence | ATGCCTTCTTTCTTTGCTCCAACCAGGAGGTTCTCCTTGGCTTCTCCTCTCCTTCTATTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |