Detail of EST/Unigene BE248210 |
Acc. | BE248210 |
Internal Acc. | NF005B02DT1F1014 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=8e-76; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=9e-75; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=2e-74; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=4e-72; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-70; |
Length | 447 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | ATAGGACTCATCACCAGAATCATGGCCATGTTGAAAATGACGAGTCTTGGCATCCGTTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830441 |
Trichome-related Gene from Literature | N/A |