Detail of EST/Unigene BE248216 |
Acc. | BE248216 |
Internal Acc. | NF005B06DT1F1046 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=1e-34; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-18; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-17; Ferredoxin-1, chloroplastic OS=Solanum lycopersicum E-value=2e-16; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-16; |
Length | 319 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | ATTTGCCTTAGAAACCAAAAAAGTAGAAGAAGAAGAAGAAGAAATAATAGTAATGGCAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837639 |
Trichome-related Gene from Literature | N/A |