Detail of EST/Unigene BE248234 |
Acc. | BE248234 |
Internal Acc. | NF005D09DT1F1075 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit III, chloroplastic OS=Flaveria trinervia E-value=8e-45; Photosystem I reaction center subunit III, chloroplastic OS=Arabidopsis thaliana E-value=5e-43; Photosystem I reaction center subunit III, chloroplastic OS=Spinacia oleracea E-value=7e-41; Photosystem I reaction center subunit III, chloroplastic OS=Hordeum vulgare E-value=6e-40; Photosystem I reaction center subunit III OS=Guillardia theta E-value=2e-23; |
Length | 396 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CTCAACCAACATCATCCACTGCAGCACAAACCAAGAAAAACCAACCAACGATGTAAACTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840021 |
Trichome-related Gene from Literature | N/A |