Detail of EST/Unigene BE248235 |
Acc. | BE248235 |
Internal Acc. | NF005D10DT1F1079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=3e-21; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=5e-21; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=2e-20; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=3e-20; Beta-glucosidase 27 OS=Arabidopsis thaliana E-value=3e-20; |
Length | 453 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | AGGATGTGGATGCTGCTCAAAGATTAATATGAGTTTCAATTTGGATGGGTTTTAGAGCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825182 |
Trichome-related Gene from Literature | N/A |