Detail of EST/Unigene BE248379 |
Acc. | BE248379 |
Internal Acc. | NF004C04DT1F1022 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=4e-16; Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=4e-11; Serine hydroxymethyltransferase 2, mitochondrial OS=Flaveria pringlei E-value=1e-08; Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=1e-08; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=3e-08; |
Length | 258 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CTATCTATCTCATCTCTGAGATGGCAATGGCAATGGCTCTTCGTAGGCTTTCTTCTTCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829949 |
Trichome-related Gene from Literature | 829949 |