Detail of EST/Unigene BE248437 |
Acc. | BE248437 |
Internal Acc. | NF021C06DT1F1039 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=1e-33; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=7e-30; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=9e-25; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=5e-22; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=2e-14; |
Length | 451 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | ATTTTCCACACACACACTCTTTCTCTCTTCTCTTCTCTCTCTCTTTCATTATTGAGTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842942 |
Trichome-related Gene from Literature | N/A |