Detail of EST/Unigene BE248476 |
Acc. | BE248476 |
Internal Acc. | NF005H02DT1F1025 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II reaction center W protein, chloroplastic OS=Spinacia oleracea E-value=3e-16; Photosystem II reaction center W protein, chloroplastic OS=Arabidopsis thaliana E-value=4e-14; Photosystem II reaction center W protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-12; |
Length | 182 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CAGCCATGTCAAGCCCAGCAGCCATGGCATTGGTGGATGAAAGAATGAGTACTGAAGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817606 |
Trichome-related Gene from Literature | N/A |