Detail of EST/Unigene BE248622 |
Acc. | BE248622 |
Internal Acc. | NF022B12DT1F1094 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=7e-53; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=3e-52; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=2e-51; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=3e-50; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=1e-37; |
Length | 593 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CTCAACAGGAAGAGAAGGAAGATGGTGCTACATGGGAGAATCAAGCGGATGCTACATGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835090 |
Trichome-related Gene from Literature | N/A |