Detail of EST/Unigene BE248814 |
Acc. | BE248814 |
Internal Acc. | NF020C11DT1F1083 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=2e-32; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=7e-09; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=2e-08; Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=3e-08; |
Length | 435 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | ATTCATCAAAGCTTAGTTTGAGTTGAAGATTCCTAAAACCAACCATGGCTTCCATTGCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826626 |
Trichome-related Gene from Literature | N/A |