| Detail of EST/Unigene BE248889 |
| Acc. | BE248889 |
| Internal Acc. | NF023C11DT1F1083 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Casein kinase I homolog 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-16; Casein kinase I isoform alpha OS=Caenorhabditis elegans E-value=1e-15; Casein kinase I homolog HRR25 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-15; Casein kinase I isoform alpha OS=Drosophila melanogaster E-value=2e-15; Casein kinase I isoform epsilon OS=Mus musculus E-value=2e-14; |
| Length | 435 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | GACCAACGCCCCGACATGTTTAGAGGGACTGTTCGATATGCTAGCAGTTCATGCTCATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K02218 casein kinase 1; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K08957 casein kinase 1, alpha; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K08957 casein kinase 1, alpha |
| EC | 2.7.11.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820572 |
| Trichome-related Gene from Literature | N/A |