Detail of EST/Unigene BE249057 |
Acc. | BE249057 |
Internal Acc. | NF037C10DT1F1071 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Swertia mussotii E-value=3e-33; Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=7e-33; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=2e-28; 7-ethoxycoumarin O-deethylase OS=Helianthus tuberosus E-value=3e-27; Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=1e-26; |
Length | 414 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | TTTATGCTGGCAAGATCCTTGATATCTTCGAACGTTTGGTTGATCAACGGTTGAAGTTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00488 cytochrome P450, family 27, subfamily A (cholestanetriol 26-monooxygenase); Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07409 cytochrome P450, famil |
EC | 1.14.13.15 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840263 |
Trichome-related Gene from Literature | N/A |