| Detail of EST/Unigene BE249074 |
| Acc. | BE249074 |
| Internal Acc. | NF037G05DT1F1037 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mannan endo-1,4-beta-mannosidase 6 OS=Arabidopsis thaliana E-value=2e-19; Putative mannan endo-1,4-beta-mannosidase 5 OS=Oryza sativa subsp. japonica E-value=2e-16; Mannan endo-1,4-beta-mannosidase 4 OS=Solanum lycopersicum E-value=2e-10; Mannan endo-1,4-beta-mannosidase 7 OS=Arabidopsis thaliana E-value=2e-10; Mannan endo-1,4-beta-mannosidase 8 OS=Oryza sativa subsp. japonica E-value=1e-09; |
| Length | 208 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | TTACAGCTCAATCCTAAACTCCACAAAGAAAGGAGGGAGTGGGGCTGGAAGCCTTTTGTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831699 |
| Trichome-related Gene from Literature | N/A |