Detail of EST/Unigene BE249328 |
Acc. | BE249328 |
Internal Acc. | NF013F12LF1F1102 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=7e-55; Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=4e-49; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=2e-13; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=5e-13; Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=7e-12; |
Length | 406 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GTTCCTAGAGGCAACAAAGGAGGGAAAAACATGGCCTACACAAGCTCTAGTGTCGTCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842446 |
Trichome-related Gene from Literature | N/A |