Detail of EST/Unigene BE249439 |
Acc. | BE249439 |
Internal Acc. | NF019E03LF1F1021 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=1e-42; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Dunaliella tertiolecta E-value=4e-17; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=2e-15; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=2e-15; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=2e-15; |
Length | 464 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AAAACCAACCATGGCTTCCATTGCTGCTTCTACTGCAGCTGCTTCACTTGGAATGTCTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826626 |
Trichome-related Gene from Literature | N/A |