Detail of EST/Unigene BE249471 |
Acc. | BE249471 |
Internal Acc. | NF020C01LF1F1004 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=3e-32; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-31; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-31; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=7e-31; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-31; |
Length | 316 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGGCTCTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |