Detail of EST/Unigene BE249566 |
Acc. | BE249566 |
Internal Acc. | NF022E05LF1F1038 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=5e-15; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=6e-14; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-08; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-08; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-08; |
Length | 182 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CATAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGGCTCTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |