Detail of EST/Unigene BE249749 |
Acc. | BE249749 |
Internal Acc. | NF021G09LF1F1071 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=2e-74; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=2e-70; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=4e-65; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=8e-65; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=1e-64; |
Length | 542 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AAGAGAACAAACATCAAGAAACCTCAACGCCCTCATGGCCACCTCTGCAATCCAACAATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815058 |
Trichome-related Gene from Literature | N/A |