Detail of EST/Unigene BE249792 |
Acc. | BE249792 |
Internal Acc. | NF022G08LF1F1067 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=9e-69; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=5e-63; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=4e-42; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=1e-41; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-41; |
Length | 440 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GCTCAGCAGCTGTTGTTAAACAAACTCCTTTCCTTGGTCAAAGGAAGGGTGCTGCCAACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |