| Detail of EST/Unigene BE249798 |
| Acc. | BE249798 |
| Internal Acc. | NF022H02LF1F1026 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit V, chloroplastic OS=Arabidopsis thaliana E-value=1e-49; Photosystem I reaction center subunit V, chloroplastic OS=Spinacia oleracea E-value=2e-45; Photosystem I reaction center subunit V, chloroplastic OS=Hordeum vulgare E-value=2e-42; Photosystem I reaction center subunit V, chloroplastic OS=Tortula ruralis E-value=7e-23; Photosystem I reaction center subunit V (Fragment) OS=Pisum sativum E-value=7e-15; |
| Length | 344 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | GTCAACACATTCACACCAAGCAAAAAGAGATTTTCAAGTCTTGTTGTCAAAGCTGAACTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842016 |
| Trichome-related Gene from Literature | N/A |