Detail of EST/Unigene BE315643 |
Acc. | BE315643 |
Internal Acc. | NF024D06LF1F1057 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Vicianin hydrolase (Fragment) OS=Vicia sativa subsp. nigra E-value=5e-44; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=5e-26; Beta-glucosidase 17 OS=Arabidopsis thaliana E-value=7e-26; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=3e-25; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=4e-24; |
Length | 335 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CTTGACTTCTTTTTTGGATGGTTTGCTCATCCCATTACATATGGTCACTATCCCCAATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819055 |
Trichome-related Gene from Literature | N/A |