| Detail of EST/Unigene BE315959 |
| Acc. | BE315959 |
| Internal Acc. | NF028G04LF1F1024 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II reaction center W protein, chloroplastic OS=Spinacia oleracea E-value=5e-23; Photosystem II reaction center W protein, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; Photosystem II reaction center W protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-11; Photosystem II reaction center W protein, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-06; |
| Length | 378 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CTTAAAACAAAAATTAAAATGGCAACCATCTCACCTACCACTACAACTGCATCGATCACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817606 |
| Trichome-related Gene from Literature | N/A |