Detail of EST/Unigene BE315959 |
Acc. | BE315959 |
Internal Acc. | NF028G04LF1F1024 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II reaction center W protein, chloroplastic OS=Spinacia oleracea E-value=5e-23; Photosystem II reaction center W protein, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; Photosystem II reaction center W protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-11; Photosystem II reaction center W protein, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-06; |
Length | 378 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CTTAAAACAAAAATTAAAATGGCAACCATCTCACCTACCACTACAACTGCATCGATCACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817606 |
Trichome-related Gene from Literature | N/A |