| Detail of EST/Unigene BE315996 |
| Acc. | BE315996 |
| Internal Acc. | NF029D06LF1F1046 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase T1 OS=Arabidopsis thaliana E-value=4e-53; Glutathione S-transferase T2 OS=Arabidopsis thaliana E-value=4e-50; Glutathione S-transferase T3 OS=Arabidopsis thaliana E-value=2e-49; Glutathione S-transferase theta-2 OS=Rattus norvegicus E-value=6e-27; Glutathione S-transferase theta-2 OS=Mus musculus E-value=4e-26; |
| Length | 385 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | GAGAGATGAAGCTGAAAGTGTATGCGGACCGTATGTCCCAGCCATCTCGTGCGATTCTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834123 |
| Trichome-related Gene from Literature | N/A |