Detail of EST/Unigene BE316144 |
Acc. | BE316144 |
Internal Acc. | NF032H01LF1F1012 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Spinacia oleracea E-value=8e-61; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Arabidopsis thaliana E-value=2e-57; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Triticum aestivum E-value=4e-50; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-34; |
Length | 580 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AAACAACATCCTCATCAAAACTTTTCAACATAATTTTTTTTTCAGCCATGGAAACTAGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824746 |
Trichome-related Gene from Literature | N/A |