| Detail of EST/Unigene BE316198 |
| Acc. | BE316198 |
| Internal Acc. | NF030D05LF1F1042 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=2e-35; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=8e-32; Chlorophyll a-b binding protein CP24 10B, chloroplastic OS=Solanum lycopersicum E-value=2e-15; Chlorophyll a-b binding protein CP24, chloroplastic OS=Spinacia oleracea E-value=2e-14; Chlorophyll a-b binding protein CP24 10A, chloroplastic OS=Solanum lycopersicum E-value=2e-13; |
| Length | 387 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CAAAACTCACAAAACTTACTCACTTTTATCCCTTGAGGGCAAGAACAGTATCATGGCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825320 |
| Trichome-related Gene from Literature | N/A |