Detail of EST/Unigene BE316198 |
Acc. | BE316198 |
Internal Acc. | NF030D05LF1F1042 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=2e-35; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=8e-32; Chlorophyll a-b binding protein CP24 10B, chloroplastic OS=Solanum lycopersicum E-value=2e-15; Chlorophyll a-b binding protein CP24, chloroplastic OS=Spinacia oleracea E-value=2e-14; Chlorophyll a-b binding protein CP24 10A, chloroplastic OS=Solanum lycopersicum E-value=2e-13; |
Length | 387 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAAAACTCACAAAACTTACTCACTTTTATCCCTTGAGGGCAAGAACAGTATCATGGCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825320 |
Trichome-related Gene from Literature | N/A |