Detail of EST/Unigene BE316302 |
Acc. | BE316302 |
Internal Acc. | NF032F03LF1F1027 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-82; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=9e-82; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=1e-75; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=5e-75; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-75; |
Length | 578 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGGCTCTCTCTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |