Detail of EST/Unigene BE316573 |
Acc. | BE316573 |
Internal Acc. | NF057B11LF1F1089 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor A protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-11; Replication protein A 70 kDa DNA-binding subunit OS=Xenopus laevis E-value=7e-08; Replication protein A 70 kDa DNA-binding subunit OS=Mus musculus E-value=2e-07; Replication protein A 70 kDa DNA-binding subunit OS=Homo sapiens E-value=5e-07; Replication protein A 70 kDa DNA-binding subunit OS=Drosophila melanogaster E-value=8e-07; |
Length | 540 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GTTGACTAAATTTTATGTTGTGCATCGAATTTTGCACGAAAAAAATCCAAGATTGAAAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K07466 replication factor A1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834576 |
Trichome-related Gene from Literature | N/A |