| Detail of EST/Unigene BE316761 |
| Acc. | BE316761 |
| Internal Acc. | NF066G09LF1F1068 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phospholipase A1-Igamma3, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; Phospholipase A1-Igamma1, chloroplastic OS=Arabidopsis thaliana E-value=9e-09; Phospholipase A1-Igamma2, chloroplastic OS=Arabidopsis thaliana E-value=1e-07; |
| Length | 143 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CCTACGTTGCACATACTCGATGGATACCATGGGAGCAACCGTGGATATTAAGCAACAACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841569 |
| Trichome-related Gene from Literature | N/A |